logo nnov-mebel.ru NNOV-MEBEL.RU | Личный кабинет | Контакты | Доставка товара

Дисплей RocknParts для Huawei Honor 5c / 7 Lite в сборе с тачскрином Black 475100

Table S1. Microarray data (XLS, 1.19 MB) - Blood Journal

4, 211337_s_at, 76P, 307, 435, gamma tubulin ring complex protein (76p gene) ...... 744, 220071_x_at, C15orf25, 571, chromosome 15 open reading frame 25 ...... 4751, 221104_s_at, NIPSNAP3B, 95, 213, nipsnap homolog 3B (C. elegans).

Ceník LAUFEN 2018 - Triker

1 апр. 2018 г. - 4 nm. 12 nm. 4000 nm. LAUFEN CLEAN COAT. Glazura. Keramika ... Objednávkový formulář pro zrcadla FRAME 25 ...... H401201075 4751.

Ragno Frame R4YN Frame Decoro Cream 25х76

Verso25 Villeroy&Boch Vitra Vitrex Viva Ceramica Wow Yellow Stone Zirconio М-Квадрат Мозаика Экоклинкер. Выберите коллекцию. Главная. Плитка. ИТАЛИЯ. Ragno. Коллекция Frame. ... Единица измерения. М2. Размеры. 25х76. м2. кол-во. 3294 руб. Похожая плитка. Все коллекции фабрики Ragno. Вся плитка коллекции Frame.

2) Cy3_46XX_Cy5_Colo320_2 - PNAS

7 дек. 2004 г. - 4, 15916, 12054, 1, p36.33, FLJ20584, hypothetical protein ...... 657, 7614, 5761, 1, q25.3, C1orf25, chromosome 1 open reading frame 25, -0.2047, 264.6750 ...... 4751, 7986, 6049, 11, q13.1, MUS81, MUS81 endonuclease ...

agi2symbols_072808 - FTP

94, AT1G02230, ANAC004, Arabidopsis NAC domain containing protein 4 ...... 4751, AT2G40670, ARR16, ARABIDOPSIS RESPONSE REGULATOR 16 ...... 8344, AT4G19112, CPuORF25, Conserved peptide upstream open reading frame 25.

475100. 4.4751.1.900.007.1 $ # FRAME25 | Светильник горизонтальный ...

4.4751.1.900.007.1 $ # FRAME25 | Светильник горизонтальный 100см алюм. LAUFEN по цене от 12 259 р. в Москве ➢ Звоните ☎: 8 495 204 33 88 или в ...

161103_LHCN-M2_undifferentiated - Evercyte

162, ENSG00000110321, EIF4G2, eukaryotic translation initiation factor 4 gamma ...... 4751, ENSG00000129534, MIS18BP1, MIS18 binding protein 1(MIS18BP1), 23.35 ...... C19orf25, chromosome 19 open reading frame 25(C19orf25), 13.73.

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75

ГлавнаяСанфаянсМебель для ванной комнатыШкаф-зеркало для ваннойЗеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75. Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75. Характеристики. Код товара. ... Frame 25. Гарантия. 1 год.

Итальянская плитка R4YM Frame Decoro Milk 25x76...

Купить плитку R4YM Frame Decoro Milk 25x76 FRAME RAGNO в Москве. Заказать товар можно по телефону +7(495) 956-00-59 или online. Доставка по России. Фото в интерьере. Кредит Керамика – решения для жизни! ... Calce Casablanca Casablanca Pav Circus Colours Concept Pav Concept Riv Concept XT20 Eden Eko Emilia Energy Epoca Fantasy Feel Flex Focus Fornace Frame Freestyle Freetime Galassia Game Glass Mosaic Grace Handmade Harmony Land Landscape Le Pietre Di Samarcanda Life Line Marfil Milestone Natural Pav Natural Riv Noblesse Prestige Realstone Cardoso Realstone Cardoso XT20 Realstone Jerusalem Realstone Jerusalem XT20 Realstone Quarzite.

Safco Thrill Frameless Back Guest Chair - Black Seat - Poly White ...

... Chair - Black Seat - Poly White Back - Silver Frame - 25" X 23" X 38.3" Overall Dimension (7044WH) at Walmart.com. ... Safco, SAF4751BV, Zenergy Ball…

Купить 4 Frame HD Electric Stainless Steel Honey Extractor...

Купить товар для пчеловодства 4 Frame HD Electric Stainless Steel Honey Extractor на eBay.com в каталоге товаров известных брендов из Америки Закажите оригинальные брендовые вещи онлайн с доставкой из США в любой регион России, Украины, Казахстана и наслаждайтесь качеством покупки и низкими ценами! ... Товар для пчеловодства 4 Frame HD Electric Stainless Steel Honey Extractor Beekeeping Drum Equipment. 20 300,00₽ 20300RUB. 299,89$.

Supplementary Table 4 - Nature

179, A_21_P0000766, TEKT4P2, Homo sapiens tektin 4 pseudogene 2 (TEKT4P2), ...... sapiens chromosome 6 open reading frame 25 (C6orf25), transcript variant 1, mRNA [NM_025260], 80739, 4.89973 ...... 4751, A_33_P3407826, 2.66822.

Full Text Bug Listing - Xamarin Bugzilla

1 сент. 2016 г. - ... -project.com/job/test-mono-mainline/label=osx-i386/4751/testReport/MonoTests/ .... frame #4: 0x0000000106fb6844 mono`sgen_gc_lock + 4 at sgen-gc.c:3165 .... libsystem_pthread.dylib`_pthread_body + 131 > frame #25: ...

mRNA-seq - bioRxiv

8 дек. 2018 г. - 4, 3472, LRP1B, Chr3, -, 20,761,303, 22,918,609, 2,157,306, 0.37, 1.2, 0.09, A1 ...... 16.93, 27.63, 22.81, A2, chromosome 22 open reading frame 25 ...... 4751, 11324, PAXBP1, Chr11, -, 31,001,488, 31,030,845, 29,357, 12.24 ...

Blatt1

80, 725_at, C4BPB, complement component 4 binding protein, beta, 8.58, P, 8.46 ...... 2384, 80739_at, C6orf25, chromosome 6 open reading frame 25, 5.47, A ...... 4751, 2519_at, FUCA2, fucosidase, alpha-L- 2, plasma, 10.1, P, 10, P, 10.48 ...

Sheet1

4, Number of genes that passed filtering criteria: 54675 ...... 212875_s_at, Info, C21orf25, chromosome 21 open reading frame 25 ...... 4751, 4727, 2057.18862, 1147.36129, 1.79297, 201338_x_at, Info, GTF3A, general transcription factor IIIA.

emmm201302625-sm-0003-SuppTab-S1.xls

4, NM_001001130, zinc finger protein 708, Nucleus, other, 35.53961, 23.49438 ...... 669, NM_001033221, chromosome 6 open reading frame 25, Plasma Membrane ...... 4751, NM_001171024, Nup62-Il4i1 protein, Cytoplasm, other, 11.39950 ...

Tucson Daily Citizen Archives, Apr 20, 1959, p. 45 - NewspaperArchive

CAPACITY GARDEN CART only 44 I 344 only Sturdy tubular steel tray and frame 25 44 only '99 4 cubic ft. capacity 12x3.00 rubber .tire doei not cut info lawn ...

Target list - Sciomics

17 мар. 2015 г. - 4. 5. 6, Applies for the following services, Scio-Specificity Analysis ...... 1010, BC018441.1, C19orf25, chromosome 19 open reading frame 25 (C19orf25) ...... 4751, XM_378564.2, LOC400500, PREDICTED: Homo sapiens ...

TYPE text text text text integer float float text text text integer integer ...

... 10.7.3.1 1 0.04 0.09 1 20 3 1 1 1 10 1.42 1.42 1 1 1 2 3 0.2 1 1 5 4 1 1 7 0.01 ...... 1.556730e+001 4751 3.745001e+001 38 1.133923e+001 1.334340e+001 0 ...... chromosome 9 open reading frame 25 19078.5 268.635 0 1 1.968913e+002 ...

ALLGENEDay4AccessImport.xls

28, Human AF-4 mRNA; complete cds, AA017200, GF200, 2.29768, 2.38052 ...... 743.99411, 1.02920, Hs.279061, chromosome 17 open reading frame 25 ...... 4751, Human tryptophan oxygenase (TDO) mRNA; complete cds, T72422, GF200 ...

Supplementary Table 26

4, HG17PR0406S00082, 82, chr1, 2,438,690, 2,444,486, AK122589,BC043358 ...... 620, AF177342, CHROMOSOME 17 OPEN READING FRAME 25 ...... 4751, NM_006575, MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE ...

Gene function - CSIC digital

159, 16, linker for activation of T cells (LAT), transcript variant 4, 1.33350. 160, 16, nuclear ...... 2673, 6, chromosome 6 open reading frame 25 (C6orf25), transcript variant 1, 1.25730 ...... 4751, 17, transmembrane protein 11 (TMEM11), 1.21145.

21700 - SEEK

190, ACTRT1, lysosomal protein transmembrane 4 alpha. 191, ACTRT2, actin-related ...... 1426, C10orf25, chromosome 10 open reading frame 25. 1427, C10orf32 ...... 4751, DUSP18, dual specificity phosphatase 18. 4752, DUSP19, dual ...

LLId Symbol Aliases 1 A1BG ||GAB||alpha-1B-glycoprotein||A1BG ...

... type II-like kinase 4||activin A type IB receptor isoform b precursor||activin A type IB ...... light polypeptide 68kDa||NEUROFILAMENT PROTEIN, LIGHT CHAIN|| 4751 ...... domain containing 4||chromosome 17 open reading frame 25|| 51032 ...

Декор Marazzi Ragno Frame Milk R4YM 25х76

Москва, Волгоградский проспект д.32 корп 25 ТЦ "М2". +7(495)645-17-44. Отправьте заказ по адресу ... Плитка настенная Marazzi Ragno Frame Struttura 3D Aqua 25х76. Код товара:31479 Размер: 25х76 В упаковке: 6 штук / 1,14 кв.м. 2696.40 руб. / кв.м.

Affymetrix GeneChip Human Gene 1.0 ST Array - RCAI RefDIC

... A HuGene-1_0-st 2010-03-10 5928 RBBP4 retinoblastoma binding protein 4 ...... 2010-03-10 81627 C1orf25 chromosome 1 open reading frame 25 7922887 X .... member 1 7924096 A HuGene-1_0-st 2010-03-10 4751 NEK2 NIMA (never ...

Fortis Часы 638 10 11L 01 Коллекция Cosmonautis — bakinskydvor.ru

Корм Аква Меню Великан для крупных аквариумных рыб 35 г, Светильник Laufen Frame25 4 4751 1 900 007, Dolce Piccante Мини платье черное С ...

If you plan to submit a bid directly to the ... - To Parent Directory

Availability” (BC 57) to the proper office no later than 4:30 p.m. prevailing time, three (3) days prior to the letting date. ...... ASTM D 4751. Sieve No. ...... manual and have a frame 25 ft (8 m) in length supported upon multiple wheels at either end.

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75. 67 910 руб. В корзину. ... Оснащение: зеркало с подсветкой, зеркало с розеткой, сенсорный выключатель, крепления, механизм доводчика Глубина: 15.00 Система хранения: с дверками Цвет: зеркало Страна производителя: Швейцария Монтаж: подвесной Покрытие корпуса: глянцевое Тип лампы: светодиодная Тип светильника: встроенный Мощность лампы: 14.00 Область применения: бытовая Угловая конструкция: нет Асимметричность: нет Артикул: 4.0860.3.900.144.1 Страна-производитель: Швейцария Артикул: 522115.

Продукты - Komforts | Evasat

izlietnes skapītis Case for Palace, 840x375 mm, h=450 mm, 2A, spīdīgi balts. Код товара: H4834210964231. Цена. 457.00 € ...Не найдено: 4751Homework - Anton Lagosha — Stan Winston School of Character Arts ...https://forums.stanwinstonschool.com/.../homework-anton-la...Сохраненная копияПеревести эту страницу8 авг. 2017 г. - Homework for live workshop student Anton Lagosha. ... 41 4751 4745 frame_0..1 # frame 13. 41 4505 ... 41 6729 6726 frame_0..1 # frame 25.

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75...

Краткое описание: Зеркальный шкафчик LAUFEN Frame25 4.0860.3.900.144.1, алюминий, двустворчатые,зеркальная дверца,с евроразеткой и сенсорным выключателем Наличие: В наличии. Зеркальный шкафчик LAUFEN Frame 25 4.0860.3.900.144.1, алюминий, двустворчатые,зеркальная дверца,с евроразеткой и сенсорным выключателем. 52720 р. Cумма заказа: 52720 руб.

дополнительная горизонтальная подсветка laufen frame25 ...

Продажа: дополнительная горизонтальная подсветка laufen frame25 4.4751.2.900.007.1 100 см с переключателем в Москве. Доступные цены! Скидки!

loci ordered alphabetically - alfred

ALDH16A1, aldehyde dehydrogenase 16 family, member A1, 4 ... C19orf25, chromosome 19 open reading frame 25, 2 ...... MIR4751, microRNA 4751, 1.

Hypericum sampsonii - PCIDB

3,5,7-Trihydroxy-2-(4-hydroxyphenyl)-4H-1-benzopyran-4-one ...... 148223, C19orf25, chromosome 19 open reading frame 25, C00004631 ...... 4751, NEK2, HsPK21, NEK2A, NLK1, NIMA-related kinase 2 (EC:2.7.11.1), C00004631.

Table S6 - Young Lab

68, ACSL4, 2182, acyl-CoA synthetase long-chain family member 4, 1, 1, 1, 1, 1, 1, 1, 1, 7 ...... 571, C13orf25, 407975, chromosome 13 open reading frame 25, 0, 0, 0, 0 ...... 4401, NEK2, 4751, NIMA (never in mitosis gene a)-related kinase 2, 1 ...

Download - Oncotarget

53, ACBD4, acyl-CoA binding domain containing 4, 79777. 54, ACBD7 ...... 715, C18orf25, chromosome 18 open reading frame 25, 147339. 716, C19orf24 ...... 4751, PLCB1, phospholipase C, beta 1 (phosphoinositide-specific), 23236.

Processing in Detail - CCP4 Workshop Edition — DIALS documentation

The following example uses a Beta-Lactamase dataset collected using beamline I04 at Diamond Light Source, and reprocessed especially for these tutorials.

refflat_isoform

27, For multimap=3, can do a bit of work but can't do htSNP tagging ...... +, chr13, 2, 89698074, 89704870, 6796, 6796, 23, 0, chromosome 13 open reading frame 25 ...... 4751, 23153, F8A1, 23, -, chrX, 1, 153118406, 153120107, 1701, 1701 ...

here

... member 6" 62 4038 LRP4 low density lipoprotein receptor-related protein 4 63 ..... 312kDa" 453 55143 CDCA8 cell division cycle associated 8 454 4751 NEK2 ...... frame 25 7267 2205 FCER1A "Fc fragment of IgE, high affinity I, receptor for; ...

Array Design Name Agilent Human Genome CGH Microarray 44B ...

... DCP_000039.4 Positive Controls control_biosequence 20 DCP_000039.4 1 1 50 ...... Homo sapiens chromosome 1 open reading frame 25 (C1orf25), mRNA. ...... Experimental 4751 chr16:067347040-067347099 NM_004360 CDH1 Homo ...

id fpid clone acc plate well gno oclone orflen vector csite fsort ...

... Flexi type ENSG00000089820 ARHGAP4 Rho GTPase activating protein 4, ...... Flexi type ENSG00000204420 C6orf25 chromosome 6 open reading frame 25, ...... subfamily G, member 7 1 390265 4751 FXC11315 pF1KE0856 AB529277 ...

US2136210A - Method and apparatus for synchronizing strip feeding ...

Method and apparatus for synchronizing strip feeding and fabricating movements .... of the machine as a outstanding from the forward side of the frame 25 whole ...

HGNC ID Approved Symbol Approved Name Status Previous Symbols ...

... member 4 Approved WHITE2 11q23 AJ300465 NM_022169 HGNC:13886 ...... 3 Approved C11orf25, TMEM16C "chromosome 11 open reading frame 25", ...... 6p22.2 AF397301 NM_170610 HGNC:4751 HIST1H2BB histone cluster 1, ...

Подсветка Евросвет Sankara LED серебристая MRL 16W 1009 ...

... A69 300h 2Gb Silver, Светильник Laufen Frame25 4 4751 1 900 007, Конверт Сонный Гномик Облачка с меховым владышем кремовый КСО1 04641904 ...

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75

Коллеция керамической плитки Frame производителя Ragno представлена в магазине Мосплитка по доступной цене, вашему вниманию так же предлагается каталог с фото данной линейки в интерьере. ... Плитка Frame Plum 25х76 (R4YD). Характеристики. Общая информация. Стиль коллекции моноколор / современный. Производитель Ragno. Категория плитка. Страна Италия. Артикул R4YD.

haltorf_cryptic_tis

4, 36920, NM_017880, Homo sapiens chromosome 2 open reading frame 42 ...... chromosome 7 open reading frame 25 (C7orf25), transcript variant 2, mRNA, 2 ...... associated protein 1 (BZRAP1), transcript variant 1, mRNA, 2, 4751, 5067, 1 ...

Smoby Тележка с инструментами Самолеты 500252 купить в ...

... Колготки женские Filodoro Classic Cotton Cashmere цвет Nero черный C113972CL Размер 4, Светильник Laufen Frame25 4 4751 1 900 007, Ideal Lux ...

Interactor_A_Entrez_Gene_ID Interactor_A_Gene_Symbol ...

... no 4089 SMAD4 SMAD family member 4 5.65706203589174 4090 SMAD5 ..... Cell Tumors no 4751 NEK2 NIMA-related kinase 2 4.75926134747611 5594 ...... chromosome 18 open reading frame 25 4.53607435140077 Testicular Germ ...

Supplemental Data

20 апр. 2010 г. - 214, 147339, C18orf25, chromosome 18 open reading frame 25, 1.78 .... 312, 151987, PPP4R2, protein phosphatase 4, regulatory subunit 2, 1.64 ...... 1048, A_23_P35219, 4751, NEK2, NIMA (never in mitosis gene a)-related ...

Картридж HP F6U13AE 953 пурпурный 700 стр — www.prime-sudak ...

4) Картридж HP F6U13AE №953 пурпурный 700 стр. ... Светильник Laufen Frame25 4 4751 1 900 007, Набор Волшебный песок Зеленый 1кг и формочка, ...

Squirrel monkey hippocampal Affymetrix GeneChip data

132, ARL6IP4, ADP-ribosylation-like factor 6 interacting protein 4, 0.00996, 0.06440 ...... 613, C7orf25, Chromosome 7 open reading frame 25, -0.08578, -0.01928 ...... 4751, CHP, Calcium binding protein P22, -0.03272, 0.07460, -0.00127 ...

txt (tab separated)

... 1 123041 XB-GENEPAGE-478287 slc24a4 solute carrier family 24 member 4 ...... binding protein 1 4751 XB-GENEPAGE-962773 nek2 NIMA-related kinase 2 ...... XB-GENEPAGE-988445 c18orf25 chromosome 18 open reading frame 25 ...

Gene Set - HCT-15

PDIA4, protein disulfide isomerase family A, member 4, 1.3454. KIAA1107, KIAA1107 .... readthrough, 0.973562. C6ORF25, chromosome 6 open reading frame 25, 0.973433 ...... synthase 1, -0.920567. MIR4751, microRNA 4751, -0.920107.

Unity 2018.2.3f1 Crashes a lot when entering playmode - Unity Forum

16 авг. 2018 г. - PackageManager (PackageManager) v2018.2.3 for Unity v2018.2.3f1 ..... frame #25: 0x00007fff36f53d23 ...... 11 Unity 0x0000000100d4751f ...

Объектив Panasonic Summilux 25mm f/1.4 Asph DG...

Важная информация о товаре Объектив Panasonic Summilux 25mm f/1.4 Asph DG (H-X025E): описание, фотографии, цены, варианты доставки, магазины на карте. ... Отличный объектив, до этого был 20, но по резкости, и насыщенности 25 - просто вне конкуренции. Крупные планы и панорамы просто шикарные. Все четко, с естественными цветами.

Probe Annotation File

... 3 AFFX-BioB-3_at J04423.1 Control 4 AFFX-BioC-5_at J04423.1 Control 5 ...... NP_002488 NIMA (NEVER IN MITOSIS GENE A)-RELATED KINASE 2 4751 ...... 2E-51 NP_057164 CHROMOSOME 17 OPEN READING FRAME 25 51031 ...

Probeset to Gene Name - UNMC

S1_at, PDIA4, protein disulfide isomerase family A, member 4, PDIA4, protein disulfide ...... S1_at, C7orf25, chromosome 7 open reading frame 25, LOC708455, hypothetical protein LOC708455 ...... 4751, MmugDNA.13600.1.

Товар не найден!

Описание. Вес. 4,25 кг. Специальный двухкомпонентный клей для фиксации сеток к трафаретным рамам из алюминия, стали, дерева и оцинкованного железа. Благодаря улучшенной формуле, обеспечивает очень надежную фиксацию и при этом НЕ требует предварительного шерохования и грунтовки профиля рамы (в отличие от других аналогичных продуктов). ... Очень хорошо наносится кисточкой. ULANO FRAME ADHESIVE-FAST быстросохнущий клей, после полного высыхания устойчив практически ко всем видам трафаретных красок и почти ко всем моющим агентам. Клей не будет крошиться и резать сетку, даже если он попадёт на внутреннюю часть сита.

Entire HaloTag Human ORF Clone Library

For an Excel spreadsheet of this table, please contact us at proteomics@promega.com. ...... 148223, FHC03833, C19orf25, chromosome 19 open reading frame 25 ...... 4751, FHC03486, NEK2, NIMA (never in mitosis gene a)-related kinase 2.

Облицовочная плитка R4YC Frame Khaki 25х76

Размеры: 25*76 см, тип поверхности: глянцевая. ... Интернет-магазин Керамическая плитка Для ванной Керамическая плитка Frame Aqua, Ragno (Италия) Ragno Плитка R4XZ Frame Milk (25*76 см). Ragno Плитка R4XZ Frame Milk (25*76 см). Ragno Плитка R4XZ Frame Milk (25*76 см). В наличии. Производитель: Ragno. Размер: 25*76 см. Стиль: Современный. Единица измерения: кв.м. Коллекция: Frame Aqua. Фабрика: Ragno. Назначение: Плитка для ванной.

Купить обои из плотной бумаги YORK из серии West Side, код ...

... Menorca4. коллекция Marmol Carrara4 ..... коллекция Frame25 ...... Купить обои бумажные YORK из серии West Side , код WE4751 выгодно через наш ...

Vesalius Image Archive: Aorto-Bilateral Carotid Bypass

vasP4725. Neck incision sites. VID 1017, frame 4 ... VID 1017, frame 25 · vasP4751. Right limb. VID 1017, frame 26 · vasP4752. Left limb. VID 1017, frame 27.

table S1 - Science Translational Medicine

7 янв. 2013 г. - 15, AP4B1, adaptor-related protein complex 4; beta 1 subunit ..... 129, C7orf25, chromosome 7 open reading frame 25, ENSG00000136197, PAP003 ...... 4751, FOLR1, folate receptor 1 (adult), ENSG00000110195, PAP45 ...

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75...

ОписаниеВнутренняя часть корпуса - анодированный алюминий Задняя стенка корпуса - серый меламин с покрытием МДФ Боковые стенки корпуса - зеркало Двусторонняя зеркальная дверь, толщиной 3+3 мм Регулируемые стеклянные полки Вертикальная подсветка Встроенные розетки EU Источник питания - 230V Степень защиты - IP44.

Arrayit 19K Human Proteome Microarray

157, BC041143.1, ACBD4, acyl-CoA binding domain containing 4, 79777, Hs ...... 1776, C10orf25, C10orf25, chromosome 10 open reading frame 25, 220979, Hs ...... 4751, BC056911.1, DUSP15, dual specificity phosphatase 15, 128853, Hs.

Supplemental Table 1 (XLSX)

4, 90326, THAP3, THAP domain containing, apoptosis associated protein 3 ...... 1019, 147339, C18orf25, chromosome 18 open reading frame 25, A_23_P345361 ...... 1375, 4751, NEK2, NIMA-related kinase 2, A_23_P35219, down, -0.72013 ...

Online Custom Frames | Collage Picture Frames | Picture Frames ...

Preserve all your life's important moments with custom frames online with Art To Frame's great collection of online frames. Call us today at 718-788-6200.

RPubs - Final Exam_Data Set2

9 дек. 2015 г. - ... Arizona 2212 4530 1.8 70.55 7.8 58.1 ## 4 Arkansas 2110 3378 1.9 70.66 .... Source: local data frame [25 x 7] ## ## stateNames Population Income ... 0.9 70.22 8.5 52.3 ## 10 Michigan 9111 4751 0.9 70.63 11.1 52.8 ## .

Supplementary Table S1

4, GS1001, NM_014901, Homo sapiens ring finger protein 44 (RNF44), mRNA ...... NM_030934, Homo sapiens chromosome 1 open reading frame 25 (C1orf25), mRNA ...... 2338, GS4751, NM_004161, Homo sapiens RAB1A, member RAS ...

Плитка R4XZ Frame Milk 25x76 Ragno (Италия) - купить...

Настенная плитка Frame. Быстрый просмотр. R4XZ Frame Milk 25.00х76.00. Цвет: Белый. Размер: 25.00x76.00. Код товара: 40160. 2 718 руб./м2. - + Быстрый просмотр. R4YA Frame Cream 25.00х76.00. Цвет: Бежевый. Размер: 25.00x76.00. ... R4YE Frame Sterling 25.00х76.00. Цвет: Серый светлый. Размер: 25.00x76.00.

Штора тюлевая на шт ленте TAC Platinum micro микровуаль ...

... Унитаз компакт Vitra S50 с функц биде сиденье микролифт механизм Geberit 9736B003, Светильник Laufen Frame25 4 4751 1 900 007, Смеситель для ...

Ragno Frame Khaki 25х76 - купить в Москве

Артикул: p48893 Размер: 25х76 см (250х760 мм) Площадь: 0,19 м2 Назначение: Плитка для ванной Тип: Плитка настенная Цвет: Белый, Синий, Голубой Тематика: Цветы, растения Поверхность: Глянцевая Производитель: Ragno Marazzi Коллекция: Frame Aqua. Плитка R4XZ Frame Milk по цене 2786р./м². Вы можете оформить доставку или купить продукцию в наших магазинах. Другие элементы коллекции. Плитка R4YF Frame Aqua. Артикул: p48892 Размер: 25*76 см Поверхность: Глянцевая. Цена: 2786 руб./м². м²Купить. Заказ в 1 клик. Плитка R4YL Frame Aqua Strutturato. Артикул: p48891 Размер: 25*76 см Поверхность: Глянцевая....

List of all genes in the Atlas by location on chromosome 19

C19orf25 · 1473.201, 19p13.3, chromosome 19 open reading frame 25 .... small nucleolar RNA, C/D box 37. PIAS4 · 4007.598, 19p13.3, protein inhibitor of activated STAT 4 ...... MIR4751 · 49933.064, 19q13.33, microRNA 4751. SIGLEC11 ...

Data

48, 65133_i_at, AI862454, high mobility group AT-hook 1-like 4, HMGA1L4, 67.5 ..... 132, 53202_at, AA402435, chromosome 7 open reading frame 25, C7orf25, 1.2 ...... 4751, 218106_s_at, NM_018141.1, mitochondrial ribosomal protein S10 ...

Плитка R4YL Frame Aqua Strutturato 25*76 (Ragno)

Цвет: СинийРектифицированная: не ректифицированнаяДизайн: МоноколорПоверхность: ГлянцеваяРазмер: 25x76. Цена: 2393 руб./м2. Купить. ... Плитка R4YJ Frame Cream Strutturato 25*76 Размер: 25x76 Код: 48065. Цена: 2393 руб./ м2. Купить. Декор R50S Frame Decoro RigheCream 25*76 Код: 48064. Цена: 1834 руб./ шт. Купить. Плитка R4YD Frame Plum 25*76 Размер: 25x76 Код: 48063. Цена: 2168 руб./ м2. Купить. Плитка R4YM Frame Decoro Milk 25*76 Размер: 25x76 Код: 48062. Цена: 3276 руб./ м2. Купить. Плитка R4YF Frame Aquq 25*76 Размер: 25x76 Код: 48061. Цена: 2168 руб./ м2. Купить. Плитка R4YC Frame Khaki 25*76 Размер: 25x76 Код: 48060. Цена: 2168 руб./ м2. Купить.

Gene list - cloudfront.net

24, TM4SF1, 7.07E-08, 3.83748, transmembrane 4 L six family member 1. 25, TOM1L2 ...... 3249, C19orf25, 0.00073, -1.89539, chromosome 19 open reading frame 25 ...... 4751, NUBP1, 0.00236, -1.57303, nucleotide binding protein 1.

Зеркало Laufen 4.4740.5.900.144.1 FRAME25 - купить, цена...

Laufen. Коллекция: Frame 25. Артикул: 4.0860.3.900.144.1. Страна: Швейцария. ... Дополнительная информация. Laufen Frame 25 4.0860.3.900.144.1 Зеркальный шкафчик с подсветкой. - алюминий, - двустворчатые зеркальные дверцы

Светильник Laufen Frame25 4.4751.1.900.007.1 быстрая ...

Светильник Laufen FRAME25 4.4751.1.900.007.1. ... Bag Laura Ashley. ₽ 4 450. Краскопульт Hammer Flex Prz350. Электрический краскопульт Hammer ...

M A T L A B (R) > Copyright 1984-2013 The MathWorks, Inc. R2013a ...

17 авг. 2017 г. - For product information, visit www.mathworks.com. ...... 273644 bytes new pixels: 49.34 % Frame 25 Load '20150204.gif' Image: 900x650 ...... 86 fps= 13 q=24.0 size= 4751kB time=6.60 bitrate=5897.6kbits/s frame= 90 fps= 13 ...

Sheet1 - ResearchGate

98, A_23_P115732, PCGF4; polycomb group ring finger 4, BC011652, Hs.380403, 648, 0.845 .... 158, A_23_P126129, C1orf25; chromosome 1 open reading frame 25 ...... 4751, A_23_P149615, ZNF281; zinc finger protein 281, AF125158 ...

sheet3

13, 6787, NEK4, NIMA (never in mitosis gene a)-related kinase 4, 25, 400, 0.01715 ...... 1090, 81627, C1orf25, chromosome 1 open reading frame 25, increased, 8, 76 ...... 4751, 645676, LOC645676, hypothetical LOC645676, 7, 218, 0.68491 ...

Кран шаровый Bugatty New Jersey 900 3 4 в н ручка 9150004 ...

Купить Кран шаровый Bugatty New Jersey 900 3 4 в н ручка 9150004 на ... 600 Pro RU Black проводная клавиатура, Светильник Laufen Frame25 4 4751 1 ...

Supp Table 1

6 янв. 2004 г. - 4, 38124368, chr19, -, 15857940, 15884209, NM_005858, Hs.25059, A kinase ...... AK074993, Hs.107149, chromosome 1 open reading frame 25, 81627 ...... 4751, 38141022, chr20, +, 60433262, 60433657, NM_014054, Hs.

NM

171, ACBD4, acyl-Coenzyme A binding domain containing 4 ...... 1813, C10orf25, chromosome 10 open reading frame 25, AACCACAACGGTCCCACGTAA ...... 4751, CMBL, carboxymethylenebutenolidase homolog (Pseudomonas) ...

Svítidla Laufen - Heureka.cz

Eglo (+4751) ..... LAUFEN FRAME 25 přídavné vodorovné osvětlení s vypínačem 900 mm 4.4750.2.900.007.1 Osvětlení k zrcadlu - vodorovné - s vypínačem ...

Supplementary Data

5, 4, 100, SLC4A7, solute carrier family 4, sodium bicarbonate cotransporter, member 7 ..... 195, 194, 96, C18orf25, chromosome 18 open reading frame 25 ...... 5179 4653 3768 3390 1093 1070 725, 1, 651, 6, 5282 4751 3644 3496 488 148 ...

Supplementary Table S2 - IOVS

132, ACAGAGCACAG, 2, ( Laminin, alpha 4;Hs.213861;AC:NM_002290;GI:9845494;r;A) ...... 4751, GTATTTAACAT, 3, ( VAMP-associated protein A, 33kDa;Hs.165195 ...... 1 open reading frame 25;Hs.107149;AC:NM_030934;GI:30181237;r;A).

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75

Весь представленный товар сертифицирован, срок гарантии от 1 года до 25 лет (в зависимости от бренда). Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75 одна из лучших на рынке моделей. Заказывайте Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75 с установкой в день доставки! Обратная связь. Все выгоды - для Вас! Отдадим со скидкой до 30%. Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75. 57 090 р. Купить.

RefseqID GeneID UnigeneID ProbesetID Description Interpro_top ...

... 4.820000171661377 0.6167910099029541 4 NM_003552 8385 - olfactory ...... chromosome X open reading frame 25 NULL () 7.800000190734863 -1 -1 -1 ...... NULL 4p16.1(+) -1 -1 -1 0.015626700595021248 4751 XM_496953 441324 ...

Table S2 - PLoS ONE

64, 346, Disgenet Chronic Hepatitis C, APOC4, apolipoprotein C-IV ...... 4, 15kDa. 982, 4751, Zheng aHCC-eHCC, NEK2, NIMA-related kinase 2 ...... 1979, 80739, Disgenet Chronic Hepatitis C, C6orf25, chromosome 6 open reading frame 25.

to access the data - Amazon AWS

4, 1 ! 5.17E-23, 1184, 83, 40, 0.482, 0.034, GO:0097458, CC, 1, neuron part ...... histone cluster 1, H2bb [Source:HGNC Symbol;Acc:HGNC:4751] ..... C7ORF25, chromosome 7 open reading frame 25 [Source:HGNC Symbol;Acc:HGNC:21703].

supplementary-table-1-total-content.xlsx

4, B01R02C15(16), BC004932.1, IOH5521, Q9BSN7, C16orf30, chromosome 16 ...... Q9Y426, C21orf25, chromosome 21 open reading frame 25 (C21orf25) ...... 4751, B25R02C17(18), BC038983.1, IOH26136, Q9P275, USP36, ubiquitin ...

Full Color Magnet/Picture Frame - 25 Mil. (3.5"x4")

$1.34 ($1.34 incl. tax) each, minimum 100; Buy 250 for $0.81 ($0.81 incl. tax) each and save 40%; Buy 500 for $0.63 ($0.63 incl. tax) each and save 53%; Buy ...

Human ORFeome v8_1-CCSB

16, 5529, 34, ACADM, acyl-CoA dehydrogenase, C-4 to C-12 straight chain. 17, 12674 ...... 2006, 14238, 4751, NEK2, NIMA (never in mitosis gene a)-related kinase 2 ...... 7978, 4654, 79020, C7orf25, chromosome 7 open reading frame 25.

LAUFEN FRAME 25 přídavné vodorovné osvětlení 1000 mm 4.4751 ...

Prohlédněte si cenové nabídky na LAUFEN FRAME 25 přídavné vodorovné osvětlení 1000 mm 4.4751.1.900.007.1 od 4 obchodů na Zboží.cz. Udělejte si ...

Лонгслив Printio Готэм экспресс — www.megastroy89.ru

Популярные товары: Компрессор Wiederkraft WDK 91032 2 2кВт, Светильник Laufen Frame25 4 4751 1 900 007, Jesus Del Pozo Desert Flowers Peony, ...

RAGNO FRAME R4XZ MILK 25X76. Новогодние акции!

Ragno. Frame. Плитка Frame Sterling 25x76 R4YE. Увеличить. Производитель: Ragno. 0 отзывов. Артикул: R4YE. Размеры: 250 x 0 x 760.

Supplemental Table 1

4, A_16_P15202412, 1, 87049316, 87049375, 208492, Homo sapiens 15 kDa ...... 216895, Homo sapiens chromosome 1 open reading frame 25 (C1orf25), mRNA. ...... 4751, A_16_P35074184, 1, 29654905, 29654964, 17695, Unknown ...

Прайс-лист на пластиковый трубопровод KPS

Pipe, 25mm, conductive. 4,35. KP 32EC200. Pipe, 32mm, conductive. 4,90. KP 54EC100 ..... KP 4751. Deburring knife. 21,60. KP 490. Pipe support holder. 1800,00. KP 505. Scraper. 17,40. KP 901 ... Cover & frame 25 ton, 530 mm. 332,60.

STOCKHOLM 1.0 #=GF ID TANGO2 #=GF AC PF05742.12 #=GF DE ...

... protein 2 homolog AAI13298.1 Chromosome 22 open reading frame 25 ortholog [Bos taurus] ...... SK-4] EYS97581.1 signal peptide protein [Cupriavidus sp. ...... protein AXG93_4751s1050 [Marchantia polymorpha subsp. ruderalis] #=GS ...

475100. дополнительная горизонтальная подсветка laufen frame25 ...

Продажа: дополнительная горизонтальная подсветка laufen frame25 4.4751.2.900.007.1 100 см с переключателем в Москве. Доступные цены! Скидки!

Table S1. Ranked nodes in the LQTS neighborhood (Excel file)

3983, 3981, C18orf25, chromosome 18 open reading frame 25, 4, 1, -0.0001 ...... 4751, SLC12A9, solute carrier family 12 (potassium/chloride transporters), ...

Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75

Покупатели, которые приобрели Зеркало-шкаф Laufen Frame 25 4.0860.3.900.144.1 100х75, также купили. Держатель туалетной бумаги Kludi A-XES 4897105. 4 350 Р. Отзывов нет. Перейти в корзину Перейти в карточку товара.

R4YE Frame Sterling Плитка настенная 25х76 - Ragno...

Плитка настенная R4YE Frame Sterling 25х76, Ragno Frame (Италия). Главная / Каталог / Ragno / Frame / R4YE Frame Sterling. код товара: 56292 R4YE Frame Sterling 25х76. Розничная цена: 2520,00 руб./кв.м.

GS1+GS2 data - PLOS

122, Hs_GRK4_5, GRK4, G protein-coupled receptor kinase 4, 486, 2364, 1.23, 31.77, 749 ...... 4174, Hs_LOC90288_1, C3orf25, chromosome 3 open reading frame 25, 2569, 3008 ...... 4751, Hs_FAH_2, FAH, fumarylacetoacetate hydrolase ...

Sheet1

2446, 11719848_x_at, C7orf25, chromosome 7 open reading frame 25, 1, 4, 4, 6 ...... 4751, 11750080_a_at, DDB2, damage specific DNA binding protein 2, 2, 1 ...

hc2

4, 23238193, 1, 1044946, 1048147, 1, TNFRSF18, NM_148901, 188.3, 453.7 ...... 514.2, 0.0099, 0.004, 241, 238, 2, 0.01172, chromosome 6 open reading frame 25 ...... 4751, 27734868, 6, 109859633, 109873263, 0, FLJ25791, NM_173559 ...

Плитка настенная Frame Aqua 25х76 от фабрики Ragno...

Вы здесь. Главная » Плитка » Frame Aqua R4YF 25*76 Плитка настенная. Frame Aqua R4YF 25*76 Плитка настенная. Изображение: Артикул: 25445. ... Все товары данной коллекции. Frame Khaki Плитка настенная 25х76. Артикул: 25443. Производитель

Art Craft Kits - Flipkart

Hivchinge 3D Pen For Kids 3D Printing Pen With Lcd Disp... ₹4,800. ₹7,800. 38% off .... Memtes ® Musical Instrument 4 In 1 Animal Toy Guitar Wi... ₹4,751. ₹7,721. 38% off ... Masterpieces Natural Wood Puzzle Frame, 25 x 25 · ₹4,695.

БИЛД Сантехническая база – Товары – Принадлежности для ...

PRAKTIK S Зеркало M960 "Ravak" X000000346 белое, 26180,00, 24350,00, 23560,00, 23040,00, 21990,00, 21210,00, 21210,00, Зеркало с полкой, ...

Pages - Search results | fsu.digital.flvc.org - Florida State University

Creator: Florida State University, Department of Anthropology; Abstract/Description: roll 1, frame 25; Identifier: FSU_ANT_Castro_Photos_0278; Format: Image ...

Table S1

42, 40, CLIC4, 25932, 0.3967, 0.0071, chloride intracellular channel 4 ...... 1993, 1991, NEK2, 4751, 0.1312, 0.1253, NIMA (never in mitosis gene a)-related kinase 2 ...... 128989, 0.0472, 0.2393, chromosome 22 open reading frame 25.

AQS Bathrooms - Online Store - Laufen - Frame25 Horizontal Lighting ...

Frame25 Horizontal Lighting 1000 x 25 x 25mm. Product Code 4.4751.1.900.007.1. Was £554.41. Sale Price NOW. £388.09. Usually 3-5 Working Day Del.

Used Size 6 Ugg boots 20 for sale in Toronto - letgo

Used Size 6 Ugg boots 20 for sale in Toronto - Size 6 Ugg boots 20 posted by Leona Wei in Toronto. - letgo.

Лист1

4, H2115020000001, Showertray SOLUTIONS -90 white, 322.92, 11,302.20 ...... 1328, H4083019001441, Mirror cabinet FRAME 25 mirro, 799.37, 27,977.95 ...... 4751, H3116290042301, CONC WALL MIX TWPLU1P225, 279.11, 9,768.85 ...

Luxart Краска спрей акриловая LuxSpray цвет бледно голубой 50 мл

4) Luxart Краска-спрей акриловая LuxSpray цвет бледно-бирюзовый 50 мл .... Светильник Laufen Frame25 4 4751 1 900 007, Nirvel Professional BLOND U ...

KPS on Request - Corrimex

pipes bring extra safety as they can be monitored for leaks. The KPS Petrol Pipe ...... Conductive manhole cover & frame, 25 ton. Clear opening .... KP 400. Pipe scissors 63 mm. For pipes up to 63 mm. 0–63 mm. 1. KP 4751. Deburring knife. 1.

4.4751.1.900.007.1 $ # FRAME25 | Светильник горизонтальный ...

4.4751.1.900.007.1 $ # FRAME25 | Светильник горизонтальный 100см алюм. LAUFEN по цене от 12 259 р. в Москве ➢ Звоните ☎: 8 495 204 33 88 или в ...

Sheet3 - Genetics

4, NM_033084, FANCD2, 2177, Fanconi anemia, complementation group D2, -0.08 ...... 501, NM_030934, C1orf25, 81627, chromosome 1 open reading frame 25 ...... 4751, NM_018419, SOX18, 54345, SRY (sex determining region Y)-box 18 ...

LAUFEN 4.4751.2.900.007.1 Frame25 Přídavné vodorovné osvětlení ...

LAUFEN 4.4751.2.900.007.1 Frame25 Přídavné vodorovné osvětlení s vypínačem 1000 x 25 x 25 mm (H4475129000071). Kód zboží, LAU-H4475129000071.

Серьги с 6 бриллиантами из белого золота 750 пробы


Серьги с 6 бриллиантами из белого золота 750 пробы

475100 РУБ

Эстет похожие

Подробнее

Комментарии


#475100 #6102 11127 #vintage mermaid prom dresses deep v neck lace long sleeve dress 2019 sexy high #коврик a4tech bloody b 072 #2pcs rc metal steel universal drive shaft cvd 42 55mm 50 70mm 60 90mm 75 122mm #2019 black deep v neck satin mermaid prom dresses long sleeves gold lace #raiber #коврик для мыши a4tech b 072 #2pcs universal steel drive shaft cvd wide angle 44mm for 3racing sakura rc 1 10 #коврик a4tech x7 200mp #mix fix #2pcs metal drive shaft 112 152mm universal cvd for 1 10 rc car truck trx4 scx10 #modern champagne prom dresses halter plunging v neck mermaid backless long #x7 200mp #hard steel front axle cvd ar44 universal drive shaft for axial scx10 ii 90046 47 #коврик для мыши a4tech b 080 #sexy deep v neck long mermaid black prom dresses 2019 gorgeous golden lace #steel front axle cvd ar44 universal drive shaft for axial scx10 ii 90046 47 rc #коврик a4tech bloody b 071 89822 #2pcs steel cardan shaft metal universal drive with cvd 90 115mm 110 150mm for #2019 burgundy deep v neck satin mermaid long prom dresses sleeves lace applique #cvd steel front rear drive shaft assembly for rc cares 1 10 slash 4x4 #коврик a4tech bloody b 070 89815 #аксессуар защитное стекло zibelino для oneplus 5t tg full screen 0 33mm 2 5d #2pcs stainless steel universal cvd drive shaft for rc crawler car axial scx10 #клавиатура a4tech kd 600 x slim black usb #sexy prom dresses 2020 lace deep v neck front slit backless evening red #hsp 1 10 55 cvd 122044 drive shaft steel 44mm 3 0pin #kd 600 x slim black usb #monami #противовес pro ject counterweight 49 49 g #v neck off shoulder long mermaid prom dress 2019 elegant sexy slim fit mother #мышь a4tech g3 220n 1 black #hsp 1 8 cvd 812110 drive shaft spring steel 110mm 2 90pin s4 suitable for #lavaza apex legends customer silicone case for samsung a3 a5 a6 plus a7 a8 a9

Подпишитесь на новые товары в nnov-mebel.ru